Is the lac operon inducible positive or negative?

Regulation of the Lac Operon

The lack of a nuclear membrane in prokaryotes gives ribosomes direct access to mRNA transcripts, allowing their immediate translation into polypeptides. This makes transcription the rate-limiting step in prokaryotic gene expression and, therefore, a major point of regulation. The classic example of prokaryotic gene regulation is that of the lac operon. This operon is a genetic unit that produces the enzymes necessary for the digestion of lactose (Fig. 16-13).

The lac operon consists of three contiguous structural genes that are transcribed as continuous mRNA by RNA polymerase. An operator sequence located at the 5′ end serves as a binding site for a repressor protein that blocks RNA polymerase. The repressor protein is produced constitutively (continuously) by the i gene, which is not under regulatory control. The repressor itself is formed from subunits that self-assemble to form the active tetramer. When present, the inducer, allolactose, binds to the repressor subunits, preventing their assembly into an active tetramer. Allolactose is produced from lactose by β-galactosidase at a steady low rate and thus serves as a lactose signal. Another regulatory component is the catabolite activator protein (CAP). CAP forms an active complex with intracellular cyclic adenosine monophosphate (cAMP), which accumulates in the absence of glucose (cAMP is a starvation signal). RNA polymerase binds to the lac promoter effectively only when the CAP-cAMP complex is also bound. This ensures that the lac operon will be expressed only when glucose is absent.

The lac operon exhibits both negative control and positive control. Under negative control, a regulatory factor is needed to prevent expression of the lac operon, whereas under positive control, a regulatory factor is needed to permit expression of the lac operon.

Negative control (conditions: glucose only; prevent expression of lac operon). If lactose is absent and glucose is present (see Fig. 16-13A), the gene products from the lac operon are not needed. Thus a regulatory factor, the repressor protein, prevents lac operon expression. Since the repressor is produced constitutively and spontaneously assembles as its active tetrameric form, it is available to bind to the operon and prevent transcription.

Positive control (conditions: lactose only; permit expression of lac operon). If no glucose is present and lactose is present (see Fig. 16-13B), the gene products from the lac operon are needed to use the lactose for energy. Thus a regulatory factor, the CAP-cAMP complex is needed to permit expression of the operon. Because cAMP is a starvation signal indicating an absence of glucose, it is available to form the CAP-cAMP complex and permit transcription.

Positive control (conditions: lactose and glucose; do not permit expression of the lac operon even if not prevented by repressor). If both lactose and glucose are present (see Fig. 16-13C), the regulatory mechanisms act to avoid wasteful expression of the lac operon. Even though the repressor is inactivated by the presence of lactose, RNA polymerase cannot bind to the promoter, since the CAP-cAMP complex is absent owing to the presence of glucose.

The lac Operon

The lactose operon (also known as the lac operon) is a set of genes that are specific for uptake and metabolism of lactose and is found in E. coli and other bacteria. The lac operon consists of three structural genes: lacZ, which codes for β-galactosidase, which acts to cleave lactose into galactose and glucose; lacY, which codes for lac permease, which is a transmembrane protein necessary for lactose uptake; and lacA, which codes for a transacetylase that transfers an acetyl group from coenzyme A (CoA) to the hydroxyl group of galactosides. In the 5′ end with respect to lacZ is the lacI gene, which encodes a repressor of the lac operon, which is transcribed independently from the structural genes (Figure 1).

In front of the lacZ gene is the promoter whose expression is modulated by the LacI repressor and the catabolite activator protein (CAP, also known as cAMP receptor protein (CRP)). Expression of this operon is activated only when lactose levels outside the cell are high and glucose levels are low. E. coli utilizes preferentially glucose and, as a result, will not activate the genes to metabolize lactose until there is a sufficiently high level of external lactose, that acts as an effector and a sufficiently low level of glucose.

Bacterial lac Operon

The lac operon in the bacterium Escherichia coli functions by a repression mechanism in which an inhibitor protein (lacI) binds to regulatory sites (lacO) in the promoter and turns off transcription (Fig. 59-2). On the addition of lactose, the lacI protein undergoes a conformational change, which changes its binding affinity for the lacO sequences. The lacI protein thereby comes off the lacO sites, and transcription can occur. E. coli uses this system to tightly control the genes required for the use of lactose, and it is completely reversible.

Activators, Repressors and Operons

•

In prokaryotes, many genes are clustered into operons and transcribed and regulated as a group.

Prokaryotic gene arrangement often includes operons, which are multiple coding regions under the control of the same promoter. Often, operons include genes involved in the same metabolic pathway, and therefore, are needed at the same time. One advantage of operons is that the genes within the operon are regulated simultaneously.

The lactose operon of E. coli is the classic example of an operon and is often used when discussing prokaryotic regulation. The lac operon consists of three coding regions in tandem, lacZ, lacY, and lacA. The lacZ gene encodes β-galactosidase, which degrades lactose. The lacY gene product, lactose permease, transports lactose into the cell, and the lacA gene product, lactose acetylase, has an unknown and not usually necessary function. The lac operon is repressed by LacI, encoded by lacI. The lacI gene is upstream of lacZYA and faces in the opposite direction. The repressor, LacI, binds to the operator sequence upstream of lacZYA and prevents transcription of those genes unless the inducer molecule is present. The inducer molecule, allo-lactose, signifies the presence of lactose. Allo-lactose binds to LacI and prevents it from repressing transcription of lacZYA, thus the operon is derepressed. In addition to allo-lactose, LacI may bind other chemicals such as IPTG (see Figures 16.11 and 16.12Figure 16.11Figure 16.12).

Activator and repressor proteins take part in positive and negative transcriptional regulation.

Some regulatory proteins may function as either a repressor or an activator depending on the situation.

Activators typically bind upstream of a promoter sequence on the DNA and help RNA polymerase bind to the promoter to initiation transcription of the genes. Repressors bind to operator sequences downstream of the promoters to prevent RNA polymerase from either binding or moving forward, which prevents transcription.

Some regulatory proteins behave as both activators and repressors, depending upon the conditions. The AraC regulatory protein is involved in regulation of the utilization of arabinose, a sugar source for cells. When arabinose binds to AraC, the regulatory protein is converted from a repressor to an activator. The araBAD and araFG operons are repressed in the absence of arabinose and activated in the presence of arabinose.

Regulatory proteins are often controlled in turn by binding small signal molecules.

Small inducer molecules often bind to repressors and change the shape of the protein such that it is no longer able to bind DNA and repress transcription of its target genes. An example includes allo-lactose for the lac operon of E. coli. Additionally, some repressors are not able to bind DNA unless they have a small signal molecule present, called a co-repressor. This type of regulation is often seen for biosynthetic pathways where if the product of the pathway is present in the cell, then the pathway is repressed.

Catabolite Repressor Protein

Conceptual Questions

1.

The lactose operon was the first operon studied, and many mutations have been created to understand how the operon functions. In genetic nomenclature, a small superscript “+” denotes that the gene is normal, whereas a superscript “-” denotes the gene is defective or mutated. When a gene is deleted, the “Δ” symbol precedes the gene designation. In the following chart, fill in the expected phenotype for each of the genetic mutants using your knowledge of lac operon control. The++++designates enzyme activity.

In E. coli, partial diploids can be created by adding an extrachromosomal ring of DNA called a plasmid that has an origin and terminator regions so it is replicated and maintained throughout each cell division. The plasmid can be modified in the lab to contain different genes such as all the genes in the lac operon. When the plasmid is introduced into the bacteria, there are two copies of each of the genes in the lac operon, and this is denoted as I+P+O+Z+Y+/I+P+O+Y+Z+ where the genes before the “/” are chromosomal and those genes after the “/” are on the plasmid. The following partial diploid, I−O+Z+Y−/I−O+Z+Y+, has β-galactosidase activity and lactose permease activity with or without an inducer. Why?

Two different types of E. coli bacteria were grown in rich broth. The first type of E. coli is wild-type for H-NS and the second type has a deletion that removes the gene for H-NS. The mRNA from each culture was isolated and analyzed for the total amount of mRNA for each of the following genes using quantitative PCR. Each mRNA is compared to an internal control mRNA, and the fold induction is presented. Based upon this data, what genes are regulated by H-NS? What type of DNA structure is most likely present in the promoter for these genes?

The trp operon is under control of an aporepressor called TrpR that binds to the operator site upstream from the biosynthetic genes of tryptophan biosynthesis. How would you expect the presence or absence of tryptophan to affect transcription of the operon? Unlike the inducible LacI repressor, aporepressors do not bind the operator site unless bound by a co-repressor. If tryptophan is the co-repressor, describe the binding of TrpR to the operator with and without tryptophan.

Look at the following promoter sequence. Underline the sequences necessary for σ54 factor binding based on the information in Table 16.01.

−40 GATCGCAGCCGGATTGGCAATATCCTTGCAATACTTAAATC +1

4 An Example: Lactose Operon in E. coli

We use the lactose operon (the lac operon) of E. coli and a modified version of the Yildirim–Mackey model (Mackey et al., 2004; Yildirim and Mackey, 2003; Yildirim et al., 2004) developed for this bacterial regulatory circuit to demonstrate the methods and analysis described in previous sections. The lac operon is the classical example of an inducible circuit which encodes the genes for the transport of external lactose into the cell and its conversion to glucose and galactose. A cartoon that depicts the major components of this circuit is shown in Fig. 12.9. The molecular mechanism of the lac operon works as follows: The lac operon has a small promoter/operator region (P and O) and three larger structural genes lacZ, lacY, and lacA. There is a regulatory gene lacI preceding the lac operon. lacI is responsible for producing a repressor (R) protein. In the presence of allolactose, a binary complex is formed between allolactose and the repressor that makes binding of the repressor to the operator region impossible. In that case, the RNA polymerase bound to the promoter is able to initiate transcription of the structural genes to produce mRNA(M). However, in the absence of allolactose (A) the repressor protein R binds to the operator region O and prevents the RNA polymerase from transcribing the structural genes. Once the mRNA has been produced, the process of translation starts. The lacZ gene encodes the portion of the mRNA that is responsible for the production of β-galactosidase (B) and translation of the lacY gene produces the section of mRNA that is ultimately responsible for the production of an enzyme permease (P). The final portion of mRNA produced by transcription of the lacA gene encodes for the production of thiogalactoside transacetylase which is thought not to play a role in the regulation of the lac operon (Beckwith, 1987). This positive control system works as follows: When there is no glucose available for cellular metabolism but if lactose (L) is available in a media, the lactose is transported into the cell by the permease. This intracellular lactose is then broken down into glucose, galactose, and allolactose by β-galactosidase. The allolactose is also converted to glucose and galactose by the same enzyme β-galactosidase. The allolactose feeds back to bind with the lactose repressor and enable the transcription process which completes the positive feedback loop.

Yildirim et. al. (Mackey et al., 2004; Yildirim and Mackey, 2003) devised a mathematical model which takes into account the dynamics of the permease, internal lactose, β-galactosidase, the allolactose interactions with the lac repressor, and mRNA. The final model consists of five nonlinear differential delay equations with delays due to the transcription and translation process. We modified this model in this study and eliminated the delay terms. This change reduced the original model to a five-dimensional system of ODEs. The equation of this model are given in Eqs. (12.25)–(12.29). The estimated values for the model parameters from the published data are listed in Table 12.1. The details on the development of this model and estimation of the parameters can be found in Mackey et al. (2004), Yildirim and Mackey (2003), Yildirim et al. (2004) (Table 12.2).

Table 12.1. The model parameters estimated from experimental data (from Yildirim and Mackey, 2003)

n2μmax3.47 × 10− 2 min− 1γM0.411 min− 1γB8.33 × 10− 4 min− 1γA0.52 min− 1Γ07.25 × 10− 7 mM/minK7200αM9.97 × 10− 4 mM/minKL11.81 mMαA1.76 × 104 min− 1KA1.95 mMαB1.66 × 10− 2 min− 1γL0.0 min− 1βA2.15 × 104 min− 1αL2880 min− 1KL9.7 × 10− 4 MKLe0.26 mMγP0.65 min− 1βL21.76 × 104 min− 1αP10.0 min− 1K12.52 × 10− 2 (μM)− 2βL12.65 × 103 min− 1KL29.7 × 10− 4 M

Table 12.2. The equations describing the evolution of the variables M, B, L, A, and P in the Yildirim–Mackey model for the lac operon

(12.25)d[M]dt=αM1+K1[A]nK+K1[A]n+Γ0−γ˜M[M].

(12.26)d[B]dt=αB[M]−γ˜B[B].

(12.27)d[L]dt=αL[P][Le]KLe+[Le]−βL1[P][L]KL1+[L]−βL2[B][L]KL2+[L]−γ˜L[L].

(12.28)dAdt=αA[B][L]KL+[L]−βA[B][A]KA+[A]−γ˜A[A].

(12.29)d[P]dt=αP[M]−γ˜P[P].

In this model γ˜i=γi+μ,i∈M,B,L,A,P.

We studied this model using both deterministic and stochastic approaches. To see if the modified model captures the experimentally observed bistable behavior (Cohn and Horibata, 1959; Novick and Wiener, 1957; Ozbudak et al., 2004), we set the left-hand side of each equation in the system Eqs. (12.25)–(12.29) to zero and solve the resultant system of five nonlinear equation for a range of Le concentration after keeping all the other parameters as in Table 12.1 for μ = 2.26 × 10− 2 min− 1. The result is shown in Fig. 12.10. Our modified model predicts that there is a physiologically range for the external lactose concentration that corresponds to the S-shaped curve in this figure. When the external lactose concentration falls in this range, the lac operon can have three coexisting steady states.

Figure 12.11 shows how the bistability arises in evolution of β-galactosidase concentration in the deterministic simulation of the model. In this simulation, all the parameters are kept constant as in Table 12.1 when μ = 2.26 × 10− 2 min− 1 and we chose [Le] as [Le] = 53 × 10− 3 mM. As shown in Fig. 12.10, there are three steady states for this particular concentration of Le. We calculate these steady state values numerically as in Table 12.3. To produce this figure, the initial values for the concentrations of all the proteins were kept constant at their steady state values on the middle branch of the S-shaped curve when [Le] = 53 × 10− 3 mM except mRNA concentration. Then three initial values of the mRNA concentration were chosen slightly below its steady value on the middle branch and another three initials were chosen slightly above its steady state concentration on the same branch and the model equations in Eqs. (12.25)–(12.29) was solved numerically for [Le] = 80 × 10− 3 mM, which corresponds to the external lactose concentration on a steady on the upper branch of the S-shaped curve. When the simulation is started from an initial starting point that is exactly on the middle branch of S-shape curve, the β-galactosidase concentration stays constant over time (the horizontal line in Fig. 12.11) as it is a steady state for this system. Since the middle branch is unstable, small perturbations around the middle branch can kick the simulation either to the lower or the upper stable branches of S-shape curve. All the other runs converge to the stable steady states either on the lower branch or on the upper branch as seen in this simulation. We observe that the ones started initially above the steady state concentration of mRNA on the middle branch converged to the steady state on the upper branch, the ones started initially below the steady state concentration of mRNA on the middle branch converged to the steady state on the lower branch.

Table 12.3. The steady state values calculated from Eqs. (12.25)–(12.29) by setting the time derivatives zero

[M*][B*][A*][L*][P*]Lower branch2.80 × 10− 61.98 × 10− 61.00 × 10− 21.88 × 10− 14.17 × 10− 5Middle branch5.33 × 10− 63.78 × 10− 62.04 × 10− 22.11 × 10− 17.93 × 10− 5Upper branch6.56 × 10− 44.65 × 10− 43.37 × 10− 12.46 × 10− 19.75 × 10− 3

Is the lac operon positive inducible?

Why is the lac operon negative inducible?

Is a inducer positive or negative control?

Is lac repressor positive or negative regulation?